m13 rev primer Search Results


90
Promega primers agcggccgctaaatataaatccgttaaaataat and m13 rev
Primers Agcggccgctaaatataaatccgttaaaataat And M13 Rev, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers agcggccgctaaatataaatccgttaaaataat and m13 rev/product/Promega
Average 90 stars, based on 1 article reviews
primers agcggccgctaaatataaatccgttaaaataat and m13 rev - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Biometra m13 rev or t7 primer
M13 Rev Or T7 Primer, supplied by Biometra, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m13 rev or t7 primer/product/Biometra
Average 90 stars, based on 1 article reviews
m13 rev or t7 primer - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

Image Search Results