90
|
Promega
primers agcggccgctaaatataaatccgttaaaataat and m13 rev Primers Agcggccgctaaatataaatccgttaaaataat And M13 Rev, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers agcggccgctaaatataaatccgttaaaataat and m13 rev/product/Promega Average 90 stars, based on 1 article reviews
primers agcggccgctaaatataaatccgttaaaataat and m13 rev - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
Biometra
m13 rev or t7 primer M13 Rev Or T7 Primer, supplied by Biometra, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/m13 rev or t7 primer/product/Biometra Average 90 stars, based on 1 article reviews
m13 rev or t7 primer - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |